Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids The WritePass Journal

Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids Abstract Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids Abstract1. Introduction1.1 Schistosomiasis1.2 Genetic diversity; transmission and epidemiology of S.mansoni1.3 Drug resistance and vaccine development1.4 Mitotic recombination in the S. mansoni life cycle causing genetic variation1.5 Studying the genetic diversity of S.mansoni using molecular techniques2. Materials and Methods  2.1 Bioinformatics – RAPD primers2.2 Comparison of DNA extraction methods: Beltran et al. (2008) and DNeasy protocol2.3 Amplification of cercariae and Schistosome hybrid DNA by Polymerase chain reaction (PCR) using RAPD primers2.4 Analysis of RAPD PCR products 2.5 Amplification of schistosome hybrid DNA by polymerase chain reaction (PCR) using ITS-2 primers and the analysis of the PCR products3. Results3.1 Bioinformatics – RAPD primers  3.2 PCR products from the amplification of DNA from cercariae using RAPD markers3.3 PCR products from the amplification of DNA from schistosome hybrids using RAPD markers3.4 PCR products from the amplification of DNA from schistosome hybrids using ITS -2 primers4. Discussion4.1 DNA extraction4.2 Evidence of mitotic recombination in Schistosomes4.3 The use of RAPD and rDNA markers in emphasising genetic diversity within schistosomesReferencesRelated Abstract Random amplified polymorphic DNA markers and second internal transcriber region primers   have been used to assess the genetic diversity of Schistosoma mansoni and Schistosoma rodhaini hybrids. 20 schistosome hybrids were used and within these parasites 6 different genotypes were present. However,1 genotype was   in females and in males and so was not sex specific. The genetic diversity within this parasite population is caused by mitotic recombination occurring in the asexual stage of the life style.   This is thought to occur due to its ability of evading the snail immune system, hybrid breakdown and increased movement and turn over of the snail host. The Red Queen Hypothesis is also suggested as a reason for genetic diversity in the schistosome population. Key words: Schistosoma mansoni, Schistosoma rodhaini, DNA extraction, polymerase chain reaction, hybrids, RAPD, mitotic recombination, genetic diversity, ITS-2. 1. Introduction 1.1 Schistosomiasis Schistosomiasis is endemic in counties where there is inadequate sanitation and no access to clean water resulting in 700 million people worldwide being at risk of infection and 207 million people already infected (World Health Organisation 2011). The leading cause is Schistosoma mansoni, a blood fluke that causes intestinal schistosomiasis. This parasite is found in Africa and South America where it is a serious health problem (Simoes et al. 2007). The disease can manifest with abdominal pain, diarrhoea, dysentry and in some severe cases cause hepatosplenomegaly which is enlargement of the liver and spleen (World Health Organisation 2011). The adult worms are found in the venules that surrond the intestine (Mann et al. 2009). It is the eggs in the tissues of the gut and deep body organs rather than the adult worms that cause of the pathology of the disease by releasing proteolytic enzymes which result in an inflammatory response (Clerinx and Gompel 2011). 1.2 Genetic diversity; transmission and epidemiology of S.mansoni The World Health Organisation (2011) have highlighted that schistosomiasis is now the second most important parasitic disease after malaria in terms of public health and economic impact, enhancing the severity of the problems that schistosomes can cause. Therefore, further research into methods which   will improve understanding of genetic variation of S. mansoni in the context of epidemiology and disease transmission in endemic areas (Durand et al. 2000). Considering the distribution of genetic diversity within the parasite population allows for a greater understand of the epidemiological factors which could influence the prevalence   of the disease (Thiele et al. 2008), especially with the concern of drug resistance and heterogeneity in virulence and pathology cause by different parasite population (Caillaud et al. 2006). 1.3 Drug resistance and vaccine development Praziquantel is commonly used to treat schistosomiasis and there is evidence to suggest resistance is becoming apparent (Ismail et al. 1999). The presence of non-synonymous mutations can affect the binding sites of drugs because these mutations are able to cause structural alterations in proteins causing drug resistance (Simoes et al. 2007). For this reason Berquist et al. (2002) suggest that a vaccine is needed against schistosomiasis as contemporary drugs such as praziquantel do not halt the transmission of the infection or stop re-infection from occurring. Due to the variability of antigens, studying the range of epitopes across the S. mansoni population is vital to vaccine development (Curtis and Minchella 2000). 1.4 Mitotic recombination in the S. mansoni life cycle causing genetic variation During the life cycle of S. mansoni (Figure 1) the miracidium infect Biomphalaria snails which act as the intermediate host which produce cercariae, humans are infected when cercariae penetrate the skin (Gryseels et al. 2006). Recombination occurs at a much lower frequency in mitosis than meiosis and is usually a rare occurrence (Archetti 2003). However, genetic diversity within the population of S. mansoni is caused by mitotic recombination during the asexual stage of the cycle (Bayne and Grevelding 2003). Grevelding (1999) also showed that the heterogeneity found among clonal cercariae all coming from a single miracidium infection, was a result of mitotic recombination events within the snail host during sporocystogenesis.   Mitosis should usually cause a single genotype, however, mitotic recombination is thought to be the cause of genetic diversity because of the presence of multiple genotypes. Figure 1 – The life cycle of Schistosoma mansoni In contrast, Sire et al. (1999) suggest that genetic diversity is greatly reduced when there is a single miracidium infection, this is justified in the study as they found that 88.4% of the snails produced single – parasite genotypes when infected with a single miracidium. However, they also found that a smaller amount of snails harboured multiple genotypes, evidential of mitotic recombination occurring. 1.5 Studying the genetic diversity of S.mansoni using molecular techniques Gower et al. (2007) suggested that a relevant problem in the in molecular studies of schistosomes is that adult worms are not easily available to study due to where they are found in the human body as they are in blood vessels that surround the intestine. Therefore, most studies involve infecting snails and using the cercariae to either infect laboratory mammals in order to extract the adult worms, or using the cercariae for their DNA and then conducting molecular studies (Gower et al. 2007). Molecular markers can be used to assess the genetic diversity by identifying parasite genotypes that have been collected from snail hosts (Dabo et al. 2007) Random amplified polymorphic DNA markers use oligonucleotides as primers to amplify DNA fragments (Lynch et al. 1994) . Sire et al. (1999) studied the genetic diversity and the distribution pattern of S.mansoni genotypes using RAPD markers and found that there were different genotypes of the parasite, 49 in total. RAPD markers are seen to be advantageous due to several factors such as quick analysis, but a major advantage is that they are able to detect numerous sequences in the DNA (Barral et al. 1996). RAPD markers are also reproducible as it is possible to the same genotype from the same individual numerous times (Figure 2 – Gel picture for reproducible RAPDs). However, an issue with using RAPD markers is that usually only highlight dominant genes (Barral et al. 1996). As they are also random a limitation is that it is not possible to know exactly where in the sequence that marker has attached itself to. Restriction fragment length polymorphisms can also be used to analyse DNA sequence differences in S.mansoni, highlighting the genetic diversity within the parasite population (Rodrigues 2002). By using other molecular markers that are highly polymorphic such as microsatellites, which are simple sequences of tandem repeated DNA (Chambers and MacAvoy 2000), the genetic diversity of S.mansoni between different hosts can be studied (Durand et al. 1995).   Gower et al. (2007) also suggest that the use of multi-locus microsatellites to highlight the genetic variation of schistosome larvae will enhance the knowledge about what is known of the epidemiology of the parasite. In this study RAPD markers were used to assess the genetic diversity of cercariae from a single miracidium infection, 10 female and 10 male S. mansoni and S. rodhaini hybrids. ITS – 2 primers were also used to discover if there was any genetic diversity amongst the second internal transcribed region of the ribosomal gene complex. The use of RAPD primers in this study should be able to show that mitotic recombination is happening within the asexual stage of the life cycle. The hypothesis of this study is to show that through the use of RAPD and ITS-2 primers mitotic recombination is occurring within the asexual stage of the schistosome life cycle. 2. Materials and Methods   2.1 Bioinformatics – RAPD primers Bioinformatic analysis was performed on 5 different RAPD primers (Table 1) to show that the primers attach themselves to random parts of the DNA sequence. The scaffold, the position in the scaffold and the features marking that part of the sequence were noted. This gave a complete genome perspective by ensuring that the primers were not binding to specific gene types or to a single region of the genome. Table   1. RAPD markers and the sequences they attach themselves to. RAPD primer Sequence OP- A9 GGGTAACGCC OP- A13 CAGCACCCAC OP G13 CTCTCCGCCA OP- A10 GTGATCGCAG OP B6 TGCTCTGCC 2.2 Comparison of DNA extraction methods: Beltran et al. (2008) and DNeasy protocol For the first DNA extractions a number of snails, Biomphalaria glabrata were infected with a single miracidium infection. In total 12 snails were infected for this experiment and 32 cercariae were collected from each snail. The DNA extraction method used on the cercariae was proposed by Beltran et al. (2008). For the DNA extraction 8 cercariae from a single snail which were each isolated   in 5 µl of purified water and then transferred to an eppendorf tube. 20 µl of NaOH (250mM) was then added to each tube and this was incubated for 15 minutes at 25 ºC. The samples were then heat shocked at 99 ºC for 2 minutes. The next step taken was to add 10 µl HCl (250mM), 5 µl   of Tris – HCl (500mM) and 5 µl   of Triton X – 100 ºC (2%) and this was again heat shocked at 99 ºC for 2 minutes. The samples were then stored at 20 ºC ready for PCR to be performed. The second method for the DNA extraction used a DNeasy protocol to extract the DNA from 20 schistosome hybrids. The hybrids used were produced from mono miracidial infections of Biomphalaria with female S.mansoni from Egypt and male S.rodhaini from Burundi from a previous experiment performed by Dr Scott Lawton. Firstly, 200 µl of AL was added to each of the schistosomehybrid DNA samples and was mixed by vortexing, following this 200 µl of ethanol was then added to each sample before vortexing again. This mixture was then placed into a DNeasy Mini spin column 2ml collection tube and centrifuged at 8000rpm for 1 minute. The DNeasy mini spin column was then placed into a new 2ml collection tube, 500 µl of buffer AW1 was added and it was again centrifuged for 1 minute at 8000rpm and again the DNeasy mini spin column was placed into a new 2ml collection tube. 500 µl of buffer AW2 was then added and was centrifuged for 3 minutes at 14 000rpm. The DNeasy column was then placed into a microcentrifuge tube and 200 µl of AE was added directly onto the DNeasy membrane, incubated at room temperature for 1 minutes and then then centrifuged at 8000rpm for 1 minute. 2.3 Amplification of cercariae and Schistosome hybrid DNA by Polymerase chain reaction (PCR) using RAPD primers PCR was performed using five primers described previously (Table 1); OP A9, OP A10, OP A13, OP G13 and OP B6. 2.5 µl of each DNA sample, 2 µl of each of the 5 different primers and 12.5 µl of PCR master mix containing Taq DNA Polymerase were added into separate PCR tubes. The DNA samples were firstly heated to 95 ºC for 15 minutes, then subjected to 40 cycles of 95 ºC for 1 minute followed by single cycles of 47 ºC for 1 minute and 72 ºC for 2 minutes. There was then a final elongation stage of 72 ºC for 10 minutes and then finally run to 4 ºC 2.4 Analysis of RAPD PCR products All PCR products were analysed using agarose gel electrophoresis was used to separate the DNA. 1% agarose gel was used in TAE and   8 µl of GelRed 10 000X in water (Biotium) was added to the gel. 5 µl   of each DNA sample was mixed with loading dye and placed into each separate well in the gel. A ladder was placed along side the DNA samples using a Bioline Hyperladder 1 ranging from 200bp to 10 000bp. The gel rack was then connected to the power supply and was allowed to run for 40 minutes. This gel was then visualised using a gel doc system. 2.5 Amplification of schistosome hybrid DNA by polymerase chain reaction (PCR) using ITS-2 primers and the analysis of the PCR products For the PCR using ITS-2 primers, 2 primers were added to each DNA sample from 5 female and 5 male schistosome hybrids, ITS-F (GGTACCGGTGGATCACGTGGTG) and ITS-R (CCTGGTTAGTTTCTTTTCCTCCGC). 2.5 µl of each DNA sample was added to a separate PCR tube, to this 12.5 µl of   PCR master mix (Thermo-Scientific) containing Taq DNA Polymerase, 5.0 µl of ITS-F and 5.0 µl of ITS-R was also added to each separate PCR tube. The PCR was then run at 95 ºC for 15 minutes, followed by 40 cycles at 95 ºC for 1 minute. The samples were then subjected to single cycles of 52 ºC for 1 minute and 72 ºC for 2 minutes and there was a final elongation stage at 72 ºC for 10 minutes before being run at 4 ºC. The PCR products were then run agarose gel electrophoresis using the same method used for the RAPD primers and the gel was visualised using a gel doc system. Sequencing of the ITS -2 regions was unsuccesful and therefore sequencing generated by Steinauer et al. (2008) were analysed to access if any mixing of the parental genotypes had occurred by identifying differences in single nucleotide polymorphisms within the F1 offspring. Sequences were downloaded from NCBI and aligned using clustalW2 (ebi.ac.uk/Tools/msa/clustalw2/). Alignments were then visualised using BioEdit to visualise nucleotide differences between the sequences. 3. Results 3.1 Bioinformatics – RAPD primers   BLAST searches on the RAPD primers showed that some of the sequences that the primers attached themselves to coded for proteins whilst others did not, highlighting that they are random (Lynch and Milligan 1994). Primers appear to bind to [rachel da1]  the different parts of the DNA sequence, for instance part of the sequence which codes for a specific protein and features marking that part of the sequence are shown. Where there is no feature it means that the sequence is a non-coding region (Table 2). Table 2. BLAST analysis on the RAPD primers 3.2 PCR products from the amplification of DNA from cercariae using RAPD markers Using the DNA extraction method suggested by Beltran et al. (2008) no PCR products were present on the gel when agarose gel electrophoresis was used (Figure 2). This method was therefore no longer used and the DNeasy kit was employed.    Figure 2. Gel picture showing that no DNA was present. 3.3 PCR products from the amplification of DNA from schistosome hybrids using RAPD markers RAPD PCR products from 10 female and 10 male schistosome hybrids were indicative that there were 4 genotypes found in the female DNA; A, B, C and D and 2 in the male DNA; E and F (Figure 3). However, genotypes D and F are the same, one being in the female population and one in the male showing that they are not sex specific. Figure 3. Showing 5 different genotypes in the schistosome hybrids. Genotype A: 1, 2, 4, 5, 6. Genotype B: 3. Genotype C: 10. Genotype D: 7, 8, 9. Genotype E: 11, 14, 17,18,20. Genotype F: 12, 13, 15, 16, 19. Table 3 shows the different sizes of each of the bands present for each genotype. Table 3. The size of bands present in each genotype 1000bp 800bp 600bp 200bp Genotype A * * * Genotype B * * * * Genotype C * * ** Genotype D * * * Genotype E * * Genotype F * * * *Band present **Double band present 3.4 PCR products from the amplification of DNA from schistosome hybrids using ITS -2 primers Double banding patterns were seen in the ITS – 2 PCR fragments, this is unexpected as the PCR should have produced a single discrete band (Figure 4). Figure 4.   Bands are present at 400bp and 200bp in both the male and female schistosome hybrids. It was not possible to sequence the ITS-2 region and so published data was used and analysed as described previously. Clear mixing of the parental genotypes can be seen (Table 4). For each SNP position mixing can be seen in the offspring with some nucleotides being from the S. mansoni parent and some from the S. rodhaini parent. [rachel da2] Table 4. Single nucleotide polymorphisms betweeen the parent species of Schistosoma mansoni (yellow) and Schistosoma rodhaini (red) and the resultant F1 offspring for published data on the ITS-1 marker. The SNPs appear not to exist as alleles and clear mixing of the parental genotypes can be seen in the offspring. SNP position 97 224 284 419 589 882 941 Species and Isolate                      (AF53134) S. mansoni A C T G C T A (AY446078) S. rodhaini G T C A G C G EU599378 G T T A G ? ? EU599377 A C T G G ? ? EU599376 A T C A G ? ? EU599375 A T C G G ? ? EU599374 A C T A G ? ? EU599373 A C C G G ? ? EU599372 A C C A G ? ? EU599371 A T T G G ? ? EU599370 G C C A G ? ? EU599369 G C C G G ? ? EU599368 G C T A G ? ? EU599367 G C T G G ? ? EU599366 G T C A G ? ? EU599365 G T C G G ? ? EU599364 G T T G G ? ? AF531313 G T C A C C G 4. Discussion 4.1 DNA extraction In this study a DNA extraction method suggested by Beltan et al. (2009) was used. An attempt at extracting DNA from 8 cercariae from a single miracidial infection of a snail and 20 Schistosome hybrids was performed and even though this DNA extraction method was said to be advantageous using small amounts of DNA , no bands were found to be present for RAPD or ITS-2 markers. Beltran et al. (2008) showed that from 10 cercariae the method was 98% and 100% successful in first and second amplifications retrospectively, however the results of this study indicate no DNA to be present suggesting that the protocol was not as 100% efficient as suggested. It could be that Beltran et al. (2008) analysed the DNA without using gel electrophoresis and other methods of analysing DNA[rachel da3]   were more suitable for this DNA extraction. However, it could also be the case that there were no cercariae to extract DNA from but this is unlikely as the cercariae were collected for the purposes of this study.[rachel da4] Alternatively, the DNeasy protocol used to extract the DNA from the adult hybrid worms proved to be more effective. Beltran et al. (2008) suggested that other methods of DNA extraction took time and were far more complex and even though this may be the case, the longer DNeasy protocol was far more effective at yielding DNA for this study. 4.2 Evidence of mitotic recombination in Schistosomes From a single miracidial infection of F1 hybrids, 6 genotypes have been produced supporting the theory by Bayne and Grevelding et al. (2003) that mitotic recombination is occurring in the asexual stage of the parasites life cycle within Biomphalaria snails. Although Sire et al. (1999) strongly suggested that genetic diversity was greatly reduced[rachel da5]   when there is a single miracidium infection the evidence from this study shows this to be incorrect due to the numerous genotypes observed. Multiple genotypes were seen in F1 generation produced from single miracidial infection which is indicative of recombination events. Recombination normally only happens during meiosis, however, this would not have had the opportunity to happen in the F1 thus recombination must have taken place during the asexual stage of of the life cycle. Hybrid breakdown occurs when the genetics that control physiology and development breakdown (Burton 1990) because of two gene pools and so two different sets of chromosomes mixing (Dobzhansky 1950). Therefore, a consequence of this hybrid breakdown could be mitotic recombination occurring and causing increased genetic diversity within the schistosome population. S. mansoni and S. rodhaini hybrids occur naturally (Morgan et al. 2003), and so it may be questionable   whether there are any pure species of schistosomes due to this naturally occuring hybridisation. Consequently if this hybridisation is occurring naturally all the time then increased genetic diversity within a schistosome population would be present. The host Biomphalaria snails only have an innate immune system (Minchella 1984). Therefore, if the parasite population has a high diversity of different genotypes the snail would not recognise them all as antigens allowing some strains to survive and so mitotic recombination could be a mechanism by which diversity arises in order for the parasite to evade the snail immune system (Caillaud et al. 2006). Sire et al. (1999) suggest that genetic diversity may be seen if there is higher productivity of snail hosts, due to an increased number of snails dying in response to a heavy parasite burden. Therefore, the different genotypes of the snail host that the parasite would be in contact with could affect the genetic diversity of the parasite. It is also suggested that if there is increased movement of the intermediate host, the Biomphalaria snail, it would encounter various different parasite genotypes from   other snail hosts (Sire et al. 1999). Therefore genetic diversity within schist osomes would be present. In this study mitotic recombination has caused greater genetic diversity in the female   parasite. This is vital for reproduction as it is the female that produces eggs (Clough 1981) therefore if more female genotypes able to evade the snail immune system and survive it means an increase in reproduction. The Red Queen Hypothesis is a co-evolutionary hypothesis suggesting that as the Biomphalaria snail host genes evolve the genes of the parasite that allow infectivity of the host will evolve alongside them (Van Valen 1973). Therefore, it could be this evolution of the parasite genes (Figure 6) affecting the ability of the schistosome population to infect the snail host which causes the genetic diversity (Carius et al. 2001). Figure 6. Red Queen Hypothesis showing the co-evolution of the snail host and the parasite. 4.3 The use of RAPD and rDNA markers in emphasising genetic diversity within schistosomes In this study the use of RAPD markers have been successful in highlighting the different genotypes present amongst S.mansoni and S.rodhaini hybrids. RAPD markers are therefore successful at allowing for genetic diversity to be quantified (Langand et al. 1999). RAPD markers have enabled the quantification of the different genotypes of the schistosome hybrids in this study and this is supported by Barral et al. (1996) who concluded that RAPD markers were efficient at providing a way of displaying genetic diversity within a schistosome population. Using reproducible RAPD markers is advantageous as it validates the results of this experiment as if the experiment was repeated the same results would be produced. If after repeating, the same results were found as reproducible RAPD markers were used it would further conclude that genetic diversity is definitely present in schistosome population. For the schistosome hybrids two ITS-2 bands were present on the gel and the reason for this is unclear. It could be due to lack of specific species barriers this second band has appeared. It could also be due to priming on another site, such as a viral or transposable element which has similarities to ITS-2 has inserted itself into the genome and how shown up on the gel as a second ITS band. Although it was not possible to sequence the ITS – 2 region, the sequencing generated by Steinauer et al. (2008) showed that there was genetic diversity within the F1 offspring. This genetic variation could also be caused by mitotic recombination happening within the asexual stage of the life cycle. References Archetti, M. (2003) A selfish origin for recombination. Journal of Theoretical Biology,  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   223(3), 335-346. Barral, V., Morand, S., Pointier, J.P., and Theron, A. (1996) Distribution of schistosome genetic diversity within naturally infected Rattus rattus detected by RAPD markers. Parasitology, 113(6), 511 – 517. Bayne, C.J., and Grevelding, C.G. (2003) Cloning of Schistosoma mansoni sporocysts in vitro and detection of genetic heterogeneity among individuals   within  Ã‚  Ã‚  Ã‚   clones. The Journal of Parasitology, 89(5), 1056-1060. Beltran, S., Galinier, R., Allienne, J., and Boissier, J. (2008) Cheap, rapid and  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  efficient DNA extraction method to perform multilocus microsatellite genotyping on all Schistosoma mansoni stages. Memà ³rias do Instituto   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Oswaldo Cruz, 103(5), 501-503. Berquist, R., Al-Sherbiny, M., Barakat, R., and Olds, R. (2002) Blueprint for schistosomiasis vaccine development. Acta tropica, 82(2), 183 – 192. Burton, R.S. (1990) Hybrid breakdown in developmental time in the copepod Tigriopus californicus. Evolution, 44(7), 1814 – 1822. Caillaud, D., Prugnolle, F., Durand, P., Theron, A. and de Meeus, T. (2006) Host sex and parasite genetic diversity. Microbes and Infection, 8(9-10), 2477 – 2483. Carius, H.J., Little, T.J. and Ebert, D. (2001) Genetic variation in host-parasite association: potential for coevolution and frequency-dependent selection. Evolution 55(6), 1136-1145. Chambers, G.K., and MacAvoy, E.S. (2000) Microsatellites: Consensus and controversy. Comparitive Biochemistry and Physiology, 126(4), 455 – 476. Clerinx, J., and Van Gompel, A. (2011) Schistosomiasis in travellers and migrants. Travel Medicine and Infections Disease, 9(1), 6-24. Clough, E.R. (1981) Morphology of Reproductive Organs and Oogenesis in Bisexual and Unisexual Transplants of Mature Schistosoma mansoni Females. The Journal of Parasitology, 67(4), 535-539. Curtis, J., and Minchella, D.J. (2000) Schistosome Population Genetic Structure: When Clumping Worms is not just splitting hairs. Parasitology Today, 16(2), 68-71. Dabo, A., Durand, P., Morand, S., Diakite, M., Langand, J., Imbert-Establet, D., Doumbo, O., and Jourdane, J. (1997) Distribution and genetic diversity of Schistosoma haematobium within its bulinid intermediate hosts in Mali. Acta Tropica, 66 (1), 15-26. Dobzhansky, T. (1950) Genetics of natural populations. XIX. Origin of heterosis through natural selection in populations of Drosophila pseudoobscura. Genetics 35(3), 288 – 302. Durand, P., Sire, C., and Theron, A. (2000) Isolation of microsatellite markers in the digenetic trematode Schistosoma mansoni from guadeloupe island. Molecular Ecology, 9(7), 997-998. Dybdahl, M.F. And Storfer, A. (2003) Parasite local adaptation: Red Queen versus Suicide King. Trends in ecology and evolution 18(10), 523-530. Gower, C.M., Shrivastava, J., Lamberton, P.H.L., Rollinson, D., Webster, B.L., Emery, A., Kabatereine, N.B., and Webster, J.P. (2007) Development and application of an ethically and epidemiologically advantageous assay for the multi-locus microsatellite analysis of Schistosoma mansoni. Parasitology, 134(4), 523-536. Grevelding, C. G. (1999) Genomic instability in Schistosoma mansoni. Molecular and Biochemical Parasitology, 101(1-2), 207-216. Gryseels, B., Polman, K., Clerinx, J., and Kestens, L. (2000) Human schistosomiasis. The Lancet, 368(9541), 1106-1118. Ismail, M., Botros, S., Metwally, A., William, S., Farghally, A., Tao, L. F., Day, T.A., and Bennett, J.L. (1999) Resistance to praziquantel: Direct evidence from Schistosoma mansoni isolated from egyptian villagers. The American Journal of Tropical Medicine and Hygiene, 60(6), 932-935. Langand, J., Theron, A., Pointier, J.P., Delay, B., and Jourdane, J. (1999) Population structure of Biomphalaria Glabrata, intermediate snail host of Schistosoma mansoni in Guadeloupe Island using RAPD markers. Journal of Molluscan Studies, 65(4), 425-433. Lynch, M., and Milligan B.G. (2004) Analysis of population genetic structure with RAPD markers. Molecular Ecology, 3(2), 91-99. Mann, V.H., Morales, M.E., Rinaldi, G., and Brindley, P.J. (2009) Culture for genetic manipulation of developmental stages of Schistosoma mansoni. Parasitology, 137(3), 451-462. Minchella, D.J. (1984) Host life-history variation in response to parasitism. Parasitology, 90(1), 205-216. Morgan, J.A.T., DeJong, R.J., Lwambo, N.J.S., Mungai, B.N., Mkoji, G.M. and Loker, E.S. (2003) First report of a natural hybrid between Schistosoma mansoni and S. rodhaini. The Journal of Parasitology, 89(2), 416-418. Rodrigues, N., Coura Filho, P., De Souza, C., Jannoti Passos, L., Dias-Neto, E., and Romanha, A. (2002) Populational structure of Schistosoma mansoni assessed by DNA microsatellites. International Journal for Parasitology, 32(7), 843-851. Simoes, M., Bahia, D., Zerlotini, A., Torres, K., Artiguenave, F., Neshich, G., Kuser, P., and Oliveira, G. (2007) Single nucleotide polymorphisms identification in expressed genes of Schistosoma mansoni. Molecular and Biochemical Parasitology, 154(2), 134-140. Sire, C., Durand, P., Pointier, J. P., and Thà ©ron, A. (1999) Genetic diversity and recruitment pattern of schistosoma mansoni in a Biomphalaria glabrata snail population: A field study using random-amplified polymorphic DNA markers. The Journal of Parasitology, 85(3), 436-441.

Digital Security Essay Example | Topics and Well Written Essays - 2000 words

Digital Security - Essay Example Digital security devices include secure personal devices such as SIM cards, smart-card based USB tokens, e-passports, secure chips in contactless payment cards, and they give an individual the freedom to shop, communicate, travel, work and bank using his or her digital identity in a manner that is enjoyable, convenient and secure. Therefore, digital security is of utmost important since a lot of information is available on the various digital platforms. Some is personal or private information and some is extremely sensitive information. Therefore, any person or firm needs to put in place security measures that ensure that the security of systems is not breached. This paper examines computer security principles, cryptology and its associated applications and secure software engineering. Computer Security Principles There are many methods and approaches that are used to secure computer systems. However, specific intrinsic expectations have to be met regardless of whether the system is large or small, or is owned by a private organization of by a government. Therefore, there exists generally accepted system security. These principles usually address computer security from an extremely high-level point, and are to be applied when developing computer security policy and programs, and in the creation of new systems, policies and practices (Guttman & Swanson, 1996). Thus, practices encompass broad areas such as accountability, integration and cost-effectiveness. Principles differ from practices in the sense that the latter guides organizations on the types of objectives, procedures and controls that constitute an effective computer security program. Principle 1: Computer Security Supports the Organization’s Mission The aim of computer security is to protect the valuable resources of an organization. These include software, hardware and information. By selecting and applying adequate safeguards, computer security supports a firm’s mission by protecting it s financial and physical resources, legal position, reputation, employees and other intangible and tangible assets (NIST, 1995). Sometimes security can be viewed as a nuisance due to the rules and procedures that are imposed on systems, users and managers. However, well-chosen security procedures and rules are there to protect significant assets as well as support the overall mission of the firm. As such, security should be viewed as a means to an end, and not an end in itself. Take an example of a private business. Usually, making profit is primary while good security is secondary. Therefore, security should be able to support this primary goal of making profit. Principle 2: Computer Security is an Integral Element of Sound Management Information and computer systems are crucial assets that support an organization’s mission. Protecting these systems is as important as the protection of other organizational resources such as employees, physical assets and money. It should be observed that the inclusion of security considerations in managing computers and information does not totally eradicate the possibility that the assets might be harmed. According to Hayden & Feringa (2004), this is why the managers of an organization have to decide the level of risk that they are ready to accept, taking into the account the costs associated with security controls. When a firm’

Journal week 4 Assignment Example | Topics and Well Written Essays - 500 words

Journal week 4 - Assignment Example Based on the above perspective, this paper discusses the evolution that marriage has undergone since 1950s, with equally changing roles for men and women in marriages, an aspect that has significantly been influenced by the changing practices in the decades such as TV shows and fashion. The 1950s depicted a decade of changes in families and their modes of operation. Such, was a period after the end of World War II and, therefore, time to start up life anew. However, a serious problem arose, as there were numerous images to depict from in determining the kind of family befitted a couple, most especially from the numerous TV shows and magazines (Lamb, 2011). Media, through its communication aspect, has determined the kinds of families’ people establish since the 1950s, with women as the main targets. The 21st century on its part is the digital age and the magazines, and TV shows play a significant role in determining the kinds of decisions people make in marriages and the roles they play. In the 1950s, women had defined futures of one getting married, having children, and being a good homemaker to the husband and the kids. However, lately, something seems amiss, and the gender roles and attitudes have changed with most women beginning the fight for autonomy (Lamb, 2011). Such an aspect has had a shift with a fundamental alteration towards the establishment of gender equality for both the women and the men (Berger, 2012). TV shows such as ‘Everybody Loves Raymond’ in the 1990s, depicts a clear picture of how run family matters have changed over time. In such shows, the man is central in the house, with all the concentrations on him; however, a problem the wife in the house who seems to attract attention equal to that of a man. In the previous TV shows, the traditional marriages depicted roles of femininity and masculinity performed conservatively, in which the man leads the home both economically and socially while the woman stays

Major Sources of Stress Essay Example for Free

Major Sources of Stress Essay 1. What are your major sources of stress? What types of problems do these create for you? Some of my major stresses right now are the fact that I don’t have a job. I am worried about my fiancà © and her health problems that she is dealing with. Another stressor is making sure my children have a Christmas. The biggest problem this creates for me is the stress it puts on my relationship because I am stressed and take things out on people around me. Another problem that it causes is the fact that I am so irritated I can’t concentrate on anything. 2. What are you currently doing to cope with your sources of stress? One thing that I am doing to cope with my stress is making sure I take my medication. The other thing that I am doing to cope with my stress is that I am trying to take things one at a time. I should be getting counseling but with everything else I have on my plate I am unable too. 3. Select two coping strategies from the chapter that youd like to try and explain how they may be helpful to you in dealing with stress. Provide examples of each. One coping strategy that I would like to try are: Taking charge of the situation. This could be helpful to me if I could get things in order as to what needs to be done first. The other strategy that I would like to use is: Talking to friends and family. This could be helpful by giving me the help that I need to get through everything. Taking charge of the situation would mean for me to get everything into perspective. If I have too many things on my plate, maybe I can get someone to help me depending on what the situation is. Talking to friends and family could help if I would just learn to talk to them. My fiancà © is one for sure that I should be talking to because of us being in this together. I know she would be willing to help me through everything that she can possibly help me with.

Racism Exposed in Fences, by August Wilson Essay -- racism, confinemen

August Wilson’s play Fences brings an introspective view of the world and of Troy Maxson’s family and friends. The title Fences displays many revelations on what the meaning and significance of the impending building of the fence in the Maxson yard represents. Wilson shows how the family and friends of Troy survive in a day to day scenario through good times and bad. Wilson utilizes his main characters as the interpreters of Fences, both literally and figuratively. Racism, confinement, and protection show what Wilson was conveying when he chose the title Fences. Lewis states that Wilson was an African American playwright, whose past of racism when he was growing up caused him to drop out of high school after a racist accusation that he had plagiarized a paper (Lewis). When Wilson wrote the play Fences he centered his main characters on this racism that he grew up with. Troy, a man who deals with his issues of failure in baseball and pride from doing right by his family, says â€Å"Why? Why you got the white mens driving and the colored lifting?...what’s the matter, don’t I count?†(Wilson 1575). This display of racism and the significance of the title fences go together hand in hand because the building of the fence in the Maxson yard is a way to show that African Americans wanted to protect their families. Rose, troy’s wife, wanted to have the fence built to protect her family against the outside world of a predominately white society. The fences also represent the barrier between African Americans and the rest of the society. Alchura says that the way Wilson uses the setting dominates the fact of racism in this play (Alchura 1). Wilson uses the following quote as a way to show how racism affected African Americans. They ... ...om. Yahoo, June-July 2009. Web. 17 July 2014vvvv. . Lewis, Miles M. "Interview with August Wilson." The Believer. The Believer, Nov. 2004. Web. 20 July 2014. . SparkNotes Editors. â€Å"SparkNotes: Fences: Character List.† SparkNotes.com. SparkNotes LLC. n.d.. Web. 17 Jul. 2014. Wilson, August. â€Å"Fences.† Literature: Reading, Reacting, Writing. Compact 7th ed. Eds. Laurie G. Kirszner and Stephen R. Mandell. Boston: Wadsworth CENGAGE, 2010. 1572-1625. Print. Zirin, David. "Tribute to August Wilson: Breaking Down Fences." Home | Common Dreams. CommonDreams.org, 14 Oct. 2005. Web. 17 July 2014. . Racism Exposed in Fences, by August Wilson Essay -- racism, confinemen August Wilson’s play Fences brings an introspective view of the world and of Troy Maxson’s family and friends. The title Fences displays many revelations on what the meaning and significance of the impending building of the fence in the Maxson yard represents. Wilson shows how the family and friends of Troy survive in a day to day scenario through good times and bad. Wilson utilizes his main characters as the interpreters of Fences, both literally and figuratively. Racism, confinement, and protection show what Wilson was conveying when he chose the title Fences. Lewis states that Wilson was an African American playwright, whose past of racism when he was growing up caused him to drop out of high school after a racist accusation that he had plagiarized a paper (Lewis). When Wilson wrote the play Fences he centered his main characters on this racism that he grew up with. Troy, a man who deals with his issues of failure in baseball and pride from doing right by his family, says â€Å"Why? Why you got the white mens driving and the colored lifting?...what’s the matter, don’t I count?†(Wilson 1575). This display of racism and the significance of the title fences go together hand in hand because the building of the fence in the Maxson yard is a way to show that African Americans wanted to protect their families. Rose, troy’s wife, wanted to have the fence built to protect her family against the outside world of a predominately white society. The fences also represent the barrier between African Americans and the rest of the society. Alchura says that the way Wilson uses the setting dominates the fact of racism in this play (Alchura 1). Wilson uses the following quote as a way to show how racism affected African Americans. They ... ...om. Yahoo, June-July 2009. Web. 17 July 2014vvvv. . Lewis, Miles M. "Interview with August Wilson." The Believer. The Believer, Nov. 2004. Web. 20 July 2014. . SparkNotes Editors. â€Å"SparkNotes: Fences: Character List.† SparkNotes.com. SparkNotes LLC. n.d.. Web. 17 Jul. 2014. Wilson, August. â€Å"Fences.† Literature: Reading, Reacting, Writing. Compact 7th ed. Eds. Laurie G. Kirszner and Stephen R. Mandell. Boston: Wadsworth CENGAGE, 2010. 1572-1625. Print. Zirin, David. "Tribute to August Wilson: Breaking Down Fences." Home | Common Dreams. CommonDreams.org, 14 Oct. 2005. Web. 17 July 2014. .

Ethical issues Essay

Similarly Newman used a correlation to interpret the findings from his study and found a relationship between undefended space and levels of crime. Correlations cannot show cause and effect, therefore other causes of these findings cannot be ruled out. One other possible explanation may have been that the different estates compared by Newman were simply in high or low crime areas, or that policing tactics of the areas was different. However in contrast Brower et al (1981) used interviews to try and establish how people felt about areas of defensible space. Interviews are a good way of obtaining rich and detailed data, however unlike Newman’s data which was factual (recorded crime figures) interview data is qualitative and needs to be interpreted by the researcher. Inevitably the way this is done may be influenced by the researchers views and therefore biased. In addition to this, as in the research by Mercer, there are issues relating to the honesty of people interviewed and providing socially acceptable responses to be considered. The research by Ley was an observation and therefore, as in Smith’s observation, this research could be argued to have greater ecological validity than research using laboratory methods, however there are problems again of observer bias affecting what is recorded. Also this study used institutionalised delinquents as participants and therefore it is difficult to generalise the results to any other situations, although the findings do have implications for institutions. Ethical issues may be particularly relevant in this study as carrying out observations of institutionalised participants may be a breach of their right to withdraw from the study. It could also be argued that if the observations were carried out by a researcher their presence may have affected the behaviour, on the other hand if video cameras were used covertly there may be a problem in ensuring that all behaviour was observed, in addition to the ethical issues mentioned. Designers and architects could use the research mentioned to ensure that working areas meant for males and females have varied sizes in order to take account of different gender needs for space. When designing housing estates architects need to ensure that the semi public areas are defensible in that they are overlooked and have markers to suggest ownership. They should also include barriers and fenced areas around homes and use plants and foliage as markers. In institutional design it would seem important to use design to clearly mark out areas in order to try and create established boundaries and reduce aggression caused by disorderly space use. It may be possible to include specific time slots for prisoners to use semi public areas to help reduce any aggression caused by dominance of most desirable areas.

Business Ethics - 9512 Words

BUSINESS ETHICS LEARNING PORTFOLIO 2011 This learning portfolio is a summary of my learning journey of Business ethics in last four months. It is a formal academic document prepared with diverse events that I have learned from all the resources in and around me. By writing and presenting this portfolio, I have achieved the unit outcomes of Business Ethics 657. Deepak Kuriacose Student ID: 14211825 Unit Coordinator: Dr .David Pick 23/05/2011 BUSINESS ETHICS: Portfolio Navigation page Structure of My Portfolio My Portfolio structured in such a way that each chapter starts with a particular concept on Business ethics which is followed by a particular piece of evidence in the form of case study, picture, video ,news article†¦show more content†¦I would like to present this academic paper with the aid of text book- „Business ethics and values‟ by Colin Fisher and Alan Lovell. I found the portfolio writing as a reliable source of learning method which will be helpful in my career. So my portfolio will show my encounters of various issues and cases during each week of my learning inside and outside the class. Thus I would like to call my report with a title called â€Å"Concepts and Cases†. The process of creating my portfolio will be interesting journey if I add more real life cases after each week‟s concepts. This report will cover 12 weeks of Business ethics seminar topics. The following are the main topics that we discussed in the lectures: 1. Introduction to business ethics 2. Ethical issues in business 3. Ethical theories and how to use them 4. Individual response to ethical issues; personal values 5. Individual response to ethical situation 6. Individual response to ethical issues; whistle blowing 7. Business response to Ethical Issues: Corporate social responsibility 8. Business response to Ethical issues: Sustainability 9. Business responses to ethical issues: ethical codes and standards 10. The International Context: Global and Local Values 11. Moral Leadership 12. Conclusion Defining the primary audience of myShow MoreRelatedBusiness Ethics : Ethics And Business943 Words   |  4 Pagesdiscussions in Business is Ethics. Some people believe that the decisions businesses make in interest of the business has no place in ethics and that they are essentially amoral. These businesses believe that their main objective is to simply make a profit and that it does not affect the success of the business. Whereas some businesses believe that they have to take ethics into consideration, in order for their business to be a success. Richard T. De George (1999) states that ethics and business do notRead MoreThe Ethics Of Business Ethics1471 Words   |  6 PagesReview Nowadays, the concern for business ethics is growing rapidly in the business community around the world. Business ethics are focused on the judgment of decisions taken by managers and their behaviors. The issue regarding these judgments is the norms and cultures that shape these judgments. Business ethics are concerned about the issue, how will the issue be solved and how will it move ahead along the transition analysis as well (Carroll, 2014). Business ethics can be addressed at differentRead MoreEthics And Ethics Of Business Ethics1304 Words   |  6 PagesBusiness Ethics Varun Shah University of Texas at Dallas Business Ethics Morals are a crucial part of life. Without having principles one would never be able to distinguish the right from wrong and good from evil. Just as it applies to life in general, ethics is an integral part of doing business as well. When we here the term Business Ethics in our work place, we usually do not take it seriously and brush it off saying ‘it’s just a simple set of basic rules like not cheating and so on’. ThisRead MoreThe Ethics Of Business Ethics Essay1097 Words   |  5 PagesResource A discusses how ethics is crucial in business. There are three key ideas used to understand this. Firstly, making ethically wrong decisions tend to cause more upset than other general mistakes as purposeful unethical actions are not as easily forgiven or forgotten. Secondly, ethics provides businesses with a broader understanding of everything to do with their business. Business ethics is effectively just business it its larger human context. Thirdly, being unethical ca n tarnish the publicRead MoreThe Ethics Of Business Ethics1064 Words   |  5 Pages　　　　Business Ethics Ethics can be viewed as the rules and values that determine goals and actions people should follow when dealing with other human beings. However, business ethics can be defined as moral principles of a business. It examines moral or ethical problems that arise in a business environment. Generally, it has both normative and descriptive dimensions. Organization practice and career specialization are regarded as normative whereas academics attempting to understand business behaviourRead MoreThe Ethics Of Business Ethics757 Words   |  4 Pagesdeciding what to do in certain situations, ethics is what guides an individual to act in a way that is good, or right. Those involved in business settings apply ethics to business situations, known as business ethics. It is expected of businesses, small and large, to follow business ethics. There is a particular framework businesses are to follow. However, the reoccurring news headlines of poor business ethics prove differently. Poor busine ss ethics include bribery, corporate accounting scandalsRead MoreEthics And Ethics Of Business Ethics1200 Words   |  5 PagesEthics meaning in simple way for average person is what is right from wrong. According to Chris MacDonald (2010)† Ethics† can be defined as the critical, structured examinations of how we should behave - in particular, how we should constrain the pursuit of self-interest when our actions affect others. â€Å"Business ethics is the applied ethics discipline that address the moral features of commercial activity (Business ethics, 2008).Working in ethical way in business has a lot of benefits which can attractRead MoreBusiness Ethics Essay944 Words   |  4 PagesUnderstanding Business Ethics Unit 37: National Diploma Assignment brief TASK 1: Scenario: Business ethics - a study of a selected company With growing interest among consumers regarding the business ethics of the businesses brands that consumers buy, Westminster council wants to conduct an independent review of some of the organisations that sell their goods and services in the borough. You have been asked to select one of the following brands and conduct research into their business ethics. Read MoreThe Ethics Of The Business Ethics1431 Words   |  6 Pages BUSINESS ETHICS INTRODUCTION:- Presentation Ethics are exceptionally regular and essential good esteem that helps us to take the right choice where we think that it hard to pick between our own advantages and the correct thing to do. We are going to talk about three sections of morals Behavioral morals, Bounded ethicality and last one is irreconcilable situation. As from the names of these parts of morals, its verging on clarifying the significance of it. It clarifies why great individualsRead MoreThe Ethics Of Business Ethics Essay2711 Words   |  11 PagesBusiness Ethics Business ethics is a type of professional ethics or applied ethics which examines moral problems and ethical principles that come up in a corporate environment. It is applied to every aspect of conducting business. According to Milton Friedman, a company has the responsibility to generate as much revenue as it can while still conforming to the basic rules that society has set. These rules include the ones embodied in customs as well as in law. Similarly, Peter Drucker stated that